|
Addgene inc
paper n a recombinant dna gecko v2 crispr grna library sanjana Paper N A Recombinant Dna Gecko V2 Crispr Grna Library Sanjana, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pmc09903835__mmc12-761-205-217?v=Addgene+inc Average 93 stars, based on 1 article reviews
paper n a recombinant dna gecko v2 crispr grna library sanjana - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
luciferase Luciferase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pm41638907-258-4-8?v=Addgene+inc Average 93 stars, based on 1 article reviews
luciferase - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
f2a gfp F2a Gfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pm38442714-262-19-24?v=Addgene+inc Average 92 stars, based on 1 article reviews
f2a gfp - by Bioz Stars,
2026-08
92/100 stars
|
Buy from Supplier |
|
Addgene inc
andrew scharenberg Andrew Scharenberg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pm40764600-502-22-24?v=Addgene+inc Average 93 stars, based on 1 article reviews
andrew scharenberg - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
zap tttgtggtgttggagaccgg Zap Tttgtggtgttggagaccgg, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pm41319291-222-16-36?v=Addgene+inc Average 94 stars, based on 1 article reviews
zap tttgtggtgttggagaccgg - by Bioz Stars,
2026-08
94/100 stars
|
Buy from Supplier |
|
Addgene inc
feng zhang Feng Zhang, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pmc09430969-172-14-16?v=Addgene+inc Average 90 stars, based on 1 article reviews
feng zhang - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
|
Addgene inc
jacob corn Jacob Corn, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/tomaleri_giovani_pinton__2023__structure_and_mechanism_of_the_human_er_membrane_protein_complex-1032-51-53?v=Addgene+inc Average 93 stars, based on 1 article reviews
jacob corn - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pen244 ctcf aid 71 114 egfp frt blast frt Pen244 Ctcf Aid 71 114 Egfp Frt Blast Frt, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pm36482254-312-88-96?v=Addgene+inc Average 93 stars, based on 1 article reviews
pen244 ctcf aid 71 114 egfp frt blast frt - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
christian frøkjær jensen Christian Frøkjær Jensen, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pmc12700905-253-9-11?v=Addgene+inc Average 93 stars, based on 1 article reviews
christian frøkjær jensen - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
trafficlight reporter Trafficlight Reporter, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pmc12900515-96-0-6?v=Addgene+inc Average 91 stars, based on 1 article reviews
trafficlight reporter - by Bioz Stars,
2026-08
91/100 stars
|
Buy from Supplier |
|
Addgene inc
plasmid pac09 ![]() Plasmid Pac09, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/bio_rxiv__2025__11__28__691108-262-4-6?v=Addgene+inc Average 93 stars, based on 1 article reviews
plasmid pac09 - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
|
Addgene inc
pym46 s20 h6 kanmx euroscarf ![]() Pym46 S20 H6 Kanmx Euroscarf, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/target+plasmid/pmc11775340__42003_2025_7569_MOESM1_ESM-62-69-84?v=Addgene+inc Average 93 stars, based on 1 article reviews
pym46 s20 h6 kanmx euroscarf - by Bioz Stars,
2026-08
93/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: Engineered symbiont biosensor maps micron-scale sugar gradients in the honeybee gut
doi: 10.1101/2025.11.28.691108
Figure Lengend Snippet: ( a ) Schematic outline of the in vivo experiment workflow. ( b ) Confocal microscopy images of a honeybee ileum co-colonized by S. alvi ac02 and G. apis ESL169 (left) or G. apicola ESL309 (right). The blue channel depicts DAPI staining of host and bacterial DNA. The green channel shows GFP fluorescence from the engineered S. alvi strain. Red channel shows E2-crimson fluorescence from the Gilliamella strains transformed with the pAC09 plasmid. Scale bar represents 100 μm. ( c ) G. apicola ESL309 catabolizes arabinose whereas G. apis ESL169 does not. Box plot shows median value of GFP fluorescence of S. alvi biofilms imaged from the gut of bees fed sugar water (-) or sugar water supplemented with 210 μM arabinose (ara). Each fluorescence value corresponds to the overall mean intensity averaged from 3 sections (anterior, mid-ileum, posterior) of one gut and across the depth of the bacterial biofilm for each section. Different letters indicate significant differences in fluorescence intensities across colonization and diet conditions, with adjusted p-value < 0.05 (Tukey HSD test). (d) Distribution of pollen-derived arabinose is longitudinally uniform along the ileum. Truncated violin plot shows median value of GFP fluorescence quantified from S. alvi biofilms imaged in the gut of bees fed sugar water (-) or sugar water and pollen ad libitum (pollen). Each fluorescence value corresponds to the mean intensity averaged across the depth of the bacterial biofilm for each gut section. (e) Arabinose derived from pollen breakdown distributes with high heterogeneity along a radial gradient across the depth of S. alvi ac02 biofilm when co-colonized with G. apis ESL169 (left) or G. apicola ESL309 (right). Graphs show the mean GFP fluorescence of the biosensor according to the biofilm depth of individual bees. Data corresponding to the anterior ileum region are displayed only for clarity. Complete data are provided in Supplementary Fig. 8.
Article Snippet: Gilliamella strains carried the
Techniques: In Vivo, Confocal Microscopy, Staining, Fluorescence, Transformation Assay, Plasmid Preparation, Derivative Assay